lsanti4575 lsanti4575

01-11-2017
Biology

contestada

What characteristics do geologists look for when observing a rock?

Respuesta :

DestinyCole DestinyCole

01-11-2017

It’s color, texture, scratch, and toughness.

Answer Link

Otras preguntas

this is a class called foundation seminar music and math

Read the following excerpt from Sandra Cisneros’s story "Mericans." They’re not from here. Ladies don’t come to church dressed in pants. And everybody knows me

Kira runs 3 miles in 28 minutes. at the same rate, how many miles would she run in 42 minutes

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The Hellenistic age was characterized by all of the following EXCEPT

3m2+7=55 answer please

What happens when energy is changed from one form to another? a. a physical change to a substance occurs. b. all of the energy can be accounted for. c. all of t

The number of degrees of freedom for a test cross of an ss/rr individual would be

Joseph and cleoma, who made the first cajun recording, were husband and wife

An element's atomic number is 64. How many protons would an atom of this element have?