Setenity10 Setenity10
  • 02-06-2017
  • Mathematics
contestada

What is the probability of rolling an odd number on the six-sided cube

Respuesta :

1rcw17 1rcw17
  • 02-06-2017
it'd be a 50% chance
Answer Link
CuteCookie33
CuteCookie33 CuteCookie33
  • 02-06-2017
3/6 or 1/2.. Hope this helped!
Answer Link

Otras preguntas

What kind of problems did increased urbanization cause? During time of industrial revolution
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
what is the most common type of vegetation throughout Latin America
what might be learned from an incorrect hypothesis
how to i do 7/16÷(31/2÷1/2)
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5