DreshawnW513162 DreshawnW513162
  • 03-11-2022
  • Mathematics
contestada

which expressions are equivalent to 5(–2k – 3) + 2k?a) (-5•3)-8kb) -15c) none of em

Respuesta :

AnaayaU468873 AnaayaU468873
  • 03-11-2022
[tex]\begin{gathered} Solving,\text{ the expression, we have,} \\ 5(-2k-3)\text{ + 2k?} \\ -10k-15+2k \\ -10k+2k-15 \\ -8K-15 \\ \text{From, the answer above, we can see that, none of the expression in the option is the same as our final answer} \\ \text{Answer = C} \end{gathered}[/tex]

Answer Link

Otras preguntas

What is the value of x?
a school cafeteria makes 4 diffrent salads during the week but serves only 2 salads each day on a roating basis. salads: chicken,fruit,pasta,tuna. a student ran
How did censorship and propaganda help fortify post ww1 dictatorships?
Which pair of verbs best completes this informal imperative sentence? ________ y _________ todo sin límite. Beba, coma Bebe, come Bebemos, comemos Bebis
The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1
If the area of a square is 32 ft2, how long is its diagonal?
punctuated equilibrium definition biology
which statement about nuclear fusion is correctA) Two hydrogen electrons become protons during fusion B) Helium nuclei xan fuse to form electrons such as nitrog
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Make w the subject of Y-aw=2w-1