missthang2781 missthang2781
  • 02-03-2022
  • History
contestada

What role did John Calvin play in the Reformation?.

Respuesta :

JKM4060
JKM4060 JKM4060
  • 02-03-2022

Answer:

John Calvin is known for his influential Institutes of the Christian Religion (1536), which was the first systematic theological treatise of the reform movement. He stressed the doctrine of predestination, and his interpretations of Christian teachings, known as Calvinism, are characteristic of Reformed churches

Explanation:

Answer Link

Otras preguntas

Which of the following was a result of having a food surplus
QUESTION 1 Harry is 20 years old and plans to retire at age 70 years with $1,600,000 in his retirement account. What amount would he have to set aside now in an
Ions, isotope, average atomic mass fill in the blank
Which correctly orders the following decimals and fractions from least to greatest?A: 0.22, 3/12, 0.75, 8/9B: 8/9, 0.75, 3/12, 0.22C: 0.22, 0.75, 8/9, 3/12D: 0.
I need help plz help!!!
What desert did Marco Polo have to cross to reach china
Determine whether the lines below are parallel, perpendicular, or neither. * y=2x+9 x-2y=-6
I need help with this question
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
A pendulum set in motion eventually stops because