Seudónimo Seudónimo
  • 03-12-2021
  • Mathematics
contestada

12.6^2 - 0^2 / 2 x 16 =

Respuesta :

Ph03niX0
Ph03niX0 Ph03niX0
  • 03-12-2021

12.6^2 - 0^2 / 2 x 16

= 4.96125

Hope this helped uyou-Have a good day bro cya)

Answer Link

Otras preguntas

Companies raise funds to expand their business by
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
Do you think then solid can undergo convection
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
how do you say theatre in Spanish
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea