casandraserrat4688 casandraserrat4688
  • 01-12-2021
  • Biology
contestada

What is photorespiration.

Respuesta :

Alisha234
Alisha234 Alisha234
  • 01-12-2021
a respiratory process in many higher plants by which they take up oxygen in the light and give out some carbon dioxide, contrary to the general pattern of photosynthesis.
Answer Link

Otras preguntas

Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
what's the percentage of 1/8 ?
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
How did the mountains in Greece contribute to the rise of city-states?
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor