esveidyjm esveidyjm
  • 01-06-2021
  • Mathematics
contestada

How to find the area using the net of a pyramid

Respuesta :

noclipskam noclipskam
  • 01-06-2021

Answer: u have to surond the permiter with people you like to help you with it

Step-by-step explanation:

Answer Link

Otras preguntas

What is the additive inverse of -4a
the table shows the elevation of 6 cities in CaliforniaCity                                                               ElevationWestmorland
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
Compliant is to stubborn as excited is to
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Compliant is to stubborn as excited is to
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Give a recursive algorithm for finding the sum of the first n odd positive integers.