siyabongahalalisani1 siyabongahalalisani1

04-04-2021
Mathematics

contestada

7. Ukuthuthuka Ngesivinini Kwezobuchwepheshe Kunomthelela Omuhle
Nomubi Kwezomnotho .[50]

Respuesta :

05-04-2021

Answer:

Thanks

Step-by-step explanation:

and also check out the language

Answer Link

Otras preguntas

Find the measure of an angle with measure between 0° and 360° that is coterminal with an angle measuring –800°.

Please help serious answers only

help plz! Evaluate. 6 + 1 x (9−4) + 6 = (?)

Traditional Mexican and Central American food is heavily influenced by the native foods of corn, beans, and tomatoes. Question 4 options: True False

The California Gold Rush Write a journal about your experience as a 49er searching for gold in California.

Choose the measures of center that you can find from this data display.1). Mean2). Mode3). None of them4). Median

Hey big men i need help with this no bots or spam PLZZZ

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

I know that the sequence models value of a car that originally cost $26,500 but loses 10% of its each year. What do you know?

A LETTER FROM THE LORAX The lorax claimed to speak for the trees. Imagine you are the lorax writing an open letter to the world on behalf of the trees. What wou