cloudiiasks cloudiiasks

04-03-2021
Mathematics

contestada

factor 5x2+6x+1 and 2x2+3x2-5 using borrow payback method

factor 5x26x1 and 2x23x25 using borrow payback method class=

Respuesta :

karlitamedina8 karlitamedina8

04-03-2021

Answer:

not sure

Step-by-step explanation:

Answer Link

Otras preguntas

what are the zeros of the function? f(x)=+-6x

The non-proliferation treaty attempts to prevent the spread of __________ weapons.

Business contracts or marriage licenses are found in which stage of relational development

the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim

How did southern slaveholders claim that the North benefited from slavery? 1. They demonstrated that slavery was the foundation of the entire American economy.

Firms can use one, no more than two, of five entry modes to enter into international markets. Exporting, Licensing, Strategic Alliances, Acquisitions, and newly

Write a compound inequality that the graph could represent.

Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

crystal lattice definition