Akeemo1118 Akeemo1118

03-08-2020
Social Studies

contestada

Cocaine and amphetamine both boost activity of___, although they do so through different mechanisms

Respuesta :

kunkcles45678 kunkcles45678

03-08-2020

Dopamine is the answer

Answer Link

Otras preguntas

Need Help Fast 33 points please Factor x2 + 10x – 18.

Occurs/Exists when the owner-manager makes all major decisions and monitors all activities while the staff serves as an extension of the managers supervisory a

What are some quotes in macbeth that show he is ambitious?

Can someone Help me with that please

14. Find the coordinates of the circumcenter for ∆DEF with coordinates D(1,3) E (8,3) and F(1,-5). Show your work.

I'm doing C++. When i multiply 200000 by 200000, i get 1345294336. I wrote long long x = 200000 * 200000 cout << x << endl;

what is r in this equation? πr^2=42π

Groups that are more formal and require less continuous interaction are known as what type of group?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?