hallethan506
hallethan506 hallethan506
  • 02-07-2020
  • Mathematics
contestada

Prove your work what is 1/12 of a dozen Branliest

Respuesta :

Space
Space Space
  • 02-07-2020

Answer:

1/12 of a dozen is 1

Step-by-step explanation:

One dozen means 12. If you ask for 1/12 of 12, you multiply 12 and 1/12. You should get 1 as your answer.

Answer Link
yaneishkamorales28
yaneishkamorales28 yaneishkamorales28
  • 02-07-2020
1/12 is a dozen of of 1
Answer Link

Otras preguntas

How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
A collection of dimes and quarters is worth 15.25. there are 103 coins in all. how many of each are there
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Simplify the expression completely. x squared over x to the power of 6
What is the value of x? x = 2 x = 3 x = 4 x = 6
Nigeria’s economy has relied on its oil industry to create jobs . When world oil prices dropped , their economy collapsed. This is a problem primarily caused by
does mercury have a magnetic field
Questions 1–10: Identify each redundant expression. Some sentences contain no redundancies. 1. Weather conditions forced the regional managers to postpone thei
How did president franklin roosevelt respond to adolf hitler's attack on the soviet union in june 1941?
Who can become an American citizen through the process of naturalization?