thegood6782
thegood6782 thegood6782
  • 04-05-2020
  • Mathematics
contestada

Someone please help me

Someone please help me class=

Respuesta :

coffmanv01
coffmanv01 coffmanv01
  • 21-10-2020

Answer:

y= 5 x=9

Step-by-step explanation:

i think im not sure!

Answer Link

Otras preguntas

Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?
Why is the epa considered to be one of the most powerful bureaucracies?
Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi
What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2
You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome
Associating objects that elicit an undesirable response with unpleasant or negative stimuli describes the key principle of ____.
Make w the subject of Y-aw=2w-1
can anyone help me to solve these 2 questions please I need very clear steps !!!!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is one key difference between the radiation and convection zones?