jeremiahlong87 jeremiahlong87

03-04-2020
Mathematics

contestada

A rectangle has a length of the fifth root of 16 inches and a width of 2 to the 1 over 5 power inches. Find the area of the rectangle

Respuesta :

wmanyango wmanyango

03-04-2020

5inches 5inches 5inches 5inches

Answer Link

Otras preguntas

Terms that have identical variable parts or two or more constant terms

What did Luther write in opposition to what was going on with the church?

Determine the mixed number that correctly adds 3/5, 5/8, and 15/32

What is the meaning of Shinto? Where do Gods come from in early Japan?

Write 3 synonyms and 3 antonyms and the definitions and a sentence for the word Burlap.

Why do the daylight hours change?

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Ana's class packs lunches for the local shelter. They make the same number of sandwiches each minute. In 5 minutes, the class makes 20 sandwiches. At this rate

Financial analysts forecast Limited Brands (LTD) growth rate for the future to be 13.5 percent. LTD’s recent dividend was $0.65. What is the value of Limited Br

Two pink-flowering plants are crossed. The offspring flower as follows: 25% red, 25% white, and 50% pink. What pattern of inheritance does flower color in these