flipthelama flipthelama
  • 03-12-2018
  • Chemistry
contestada

How might a 15% solution of flubber be made

Respuesta :

liyahcoan86
liyahcoan86 liyahcoan86
  • 03-12-2018
Adding 15 g of Flubber with 85 g of inert solvent will result in the formation of 15 % solution.

Glad to help you :)

-liyah❤
Answer Link

Otras preguntas

does mercury have a magnetic field
Cuanto es (2x+2y=20) (-2x-6y=-52) con método de igualación y método de suma y resta
How many positive odd integers less than 300 can be formed using the digits 0, 1,2,3,4?
On The Magic School Bus, you find yourself traveling from Earth to the Moon. It is approximately 240 million miles. Once there, you realize you must turn 90 deg
A _____ reaction is one that consists of two or more elementary reactions. a. simple b. complex c. single d. double
A mixture from which some of the particles settle out slowly upon standing
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is mitochondria
When the net is folded into the rectangular prism shown beside it, which letters will be on the front and back of the rectangular prism? Question 7 options: The
True or false? physical factors affecting community health include geography, community size, and industrial development.