summer1776 summer1776
  • 03-08-2018
  • Mathematics
contestada

a) solve the inequality |x-10|-9<-1 and graph the solutions.

b) then write the solutions as a "compound inequality".

Respuesta :

buggarberpcuwh7
buggarberpcuwh7 buggarberpcuwh7
  • 03-08-2018
boom I think it's been a while since I've done this
Ver imagen buggarberpcuwh7
Answer Link

Otras preguntas

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
the perimeter of a square 116ft ?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
Where did middle names come from
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the additive inverse of -4a